SubtiBank SubtiBank
ccpA [2018-08-12 18:26:55]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ccpA [2018-08-12 18:26:55]

Carbon catabolite control protein A, involved in glucose regulation of many genes; represses catabolic genes and activates genes involved in excretion of excess carbon
locus
BSU29740
pI
5.06
mw
36.78 kDa
protein length
334 aa Sequence Blast
gene length
1002 bp Sequence Blast
function
carbon catabolite repression (CCR)
product
transcriptional regulator ([SW|LacI family])
essential
no
synonyms
graR,alsA,amyR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    3,044,165 → 3,045,169

    Phenotypes of a mutant

  • Loss of carbon catabolite repression. Loss of [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI]-dependent sugar transport due to excessive phosphorylation of [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK]
  • The mutant is unable to grow on a minimal medium with glucose and ammonium as the only sources of carbon and nitrogen, respectively, this can be suppressed by mutations resulting in hyperactive [protein|41199C76DF8CA804B7B8878D61228B9542A96AE4|topoisomerase I] or in the inactivation of [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG] [pubmed|29242163,17183217]
  • The protein

    Catalyzed reaction/ biological activity

  • transcriptional regulator of carbon catabolite repression (CCR)
  • Protein family

  • [SW|LacI family]
  • [SW|Domains]

  • HTH LacI-type Domain (1 – 58)
  • DNA binding Domain (6 – 25)
  • [SW|Cofactors]

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]-Ser46-P, [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]-Ser-46-P
  • Effectors of protein activity

  • glucose-6-phosphate, fructose-1,6-bisphosphate [Pubmed|17376479]
  • Structure

  • [PDB|3OQM] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the ''[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]'' operator site)
  • [PDB|3OQN] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the ''[gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]'' operator site)
  • [PDB|3OQO] (complex of ''B. subtilis'' CcpA with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and a optimal synthetic operator site)
  • [PDB|2HSG] (apoprotein) [pubmed|17500051]
  • CcpA-[protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]-DNA-complex [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=52326 NCBI]
  • complex with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and sulphate ions [http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?Dopt=s&uid=39857 NCBI]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000022 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]-[gene|3D42584D65D80A1C73F057714647E29FF6BBD58A|motP]-[gene|6617D785D08C5919F0B774D2AF9EA6A84215486B|motS]
    description
    [Pubmed|16547058]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive
  • view in new tab

    additional information

  • there are about 3.000 molecules of CcpA per cell [http://www.ncbi.nlm.nih.gov/sites/entrez/8000527 PubMed], this corresponds to a concentration of 3 µM (according to [PubMed|20408793])
  • Biological materials

    Mutant

  • QB5407 (ccpA::spc) [Pubmed|10941796], available in [SW|Jörg Stülke]'s lab
  • GP302 (erm) [Pubmed|12123463], available in [SW|Jörg Stülke]'s lab
  • GP300 (an in frame deletion of ''[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]'') [Pubmed|11557150], available in [SW|Jörg Stülke]'s lab
  • WH649 (aphA3), available in [SW|Gerald Seidel]'s lab
  • BKE29740 (Δ[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAAAACCACTCCTTT, downstream forward: _UP4_TAAGAAAAACAAAGAGCAAG
  • BKK29740 (Δ[gene|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTAAAACCACTCCTTT, downstream forward: _UP4_TAAGAAAAACAAAGAGCAAG
  • Expression vector

  • pGP643 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pWH940 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Gerald Seidel]'s lab
  • Antibody

  • available in [SW|Gerald Seidel]'s and in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Gerald Seidel], Erlangen University, Germany [http://www.biologie.uni-erlangen.de/mibi/index2.html Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
  • [SW|Milton H. Saier], University of California at San Diego, USA [http://biology.ucsd.edu/faculty/saier.html Homepage]
  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • [SW|Oscar Kuipers], University of Groningen, The Netherlands [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 20408793,8598282,19202299,14665673,18628769,18359269
  • General and physiological studies

  • 1904524,10941796,12123463,8000527,18757537,16547058,14523131,22001508,22512862,29242163
  • Global analyses (proteome, transcriptome, ChIP-chip)

  • 12850135,11251851,10559165,11160890,17183215,22383848,22900538,26483775
  • Repression of target genes by CcpA

  • 15150224,16166551,11929549,7913927,17827291,11985717,12100558,7592486,16825793,16491025,21398533,26712933,28974613
  • Positive regulation of gene expression by CcpA

  • 8226682,12193635,10559153,15916605,9811655,10986270,25157083
  • Control of CcpA activity

  • 7623661,9973552,9334231,12051938,9689125
  • CcpA-DNA interaction

  • 8596444,10666464,15885105,7665492,9254709,21106498
  • Functional analysis of CcpA

  • 10383986,10601226,11557150,9252590,9988473
  • Structural analyses

  • 15369672,16316990,17376479,16755587,17500051,17401189,10666630